Dendrimers

University of Lodz describes research in dendrimers

Published in Gene Therapy Weekly, August 23rd, 2007

Fresh data on dendrimers are presented in the report "Analysis of interaction between dendriplexes and bovine serum albumin." According to recent research from Lodz, Poland, "Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases."

"The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the...

Want to see the full article?

Purchase this article for only $3.00

We're a pay-per-view site for premium content. If you'd like to purchase this article, it's only $3.00.

Welcome to NewsRx!

Learn more about a six-week, no-risk free trial of Gene Therapy Weekly

Source: Gene Therapy Weekly (2007-08-23)

NewsRx is Social

Top Medical Newsletters

Awards

Best Health/Healthcare Content, 2012
Best Health/Healthcare Content, 2011
Best e-Business Site, 2010
Best e-Business Site, 2009
Best e-Business Site, 2008
Best e-Business Site, 2007
Best e-Business Site, 2006
Best Healthcare Content, 2005
Best Overall Internet Site, 2005
Best Interactive Site, 2005

Facts & Stats

NewsRx also is available at LexisNexis, Gale, ProQuest, Factiva, Dialog, Thomson Reuters, NewsEdge, and Dow Jones.

Google 2010 PageRank: #2 Among Top Health News and Media Publications
Google 2010 PageRank: #2 Among Top Science Publications in Biology/Physiology
Google 2010 PageRank: #2 Among Top News and Media for the Business of Pharmaceuticals
Amazon's Alexa 2010 PageRank: #2 News and Media Site for the Pharmaceutical Industry