NewsRx

Search our medical news database

Dendrimers

University of Lodz describes research in dendrimers

Published in Gene Therapy Weekly, August 23rd, 2007

Fresh data on dendrimers are presented in the report "Analysis of interaction between dendriplexes and bovine serum albumin." According to recent research from Lodz, Poland, "Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases."

"The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the...

Want to see the full article?

We're a pay-per-view site for premium content. If you'd like to purchase this article, it's only $3.00.

Buy Now


Welcome to NewsRx!

Learn more about a six-week, no-risk free trial of Gene Therapy Weekly


NewsRx is Social

Follow us on your favorite social network by clicking on a button below:

Follow NewsRx on Twitter

NewsRx on Facebook

Awards

eHealthcare Leadership 2011 Winner
Best Health/Healthcare Content, 2012
Best Health/Healthcare Content, 2011
Best e-Business Site, 2010
Best e-Business Site, 2009
Best e-Business Site, 2008
Best e-Business Site, 2007
Best e-Business Site, 2006
Best Healthcare Content, 2005
Best Overall Internet Site, 2005
Best Interactive Site, 2005

Facts & Stats

NewsRx also is available at LexisNexis, Gale, ProQuest, Factiva, Dialog, Thomson Reuters, NewsEdge, and Dow Jones.

  • Google 2010 PageRank: #2 Among Top Health News and Media Publications
  • Google 2010 PageRank: #2 Among Top Science Publications in Biology/Physiology
  • Google 2010 PageRank: #2 Among Top News and Media for the Business of Pharmaceuticals
  • Amazon's Alexa 2010 PageRank: #2 News and Media Site for the Pharmaceutical Industry
NewsRx on Facebook